A single-chain derivative of an integrin-activating antibody potentiates organoid growth in Matrigel and collagen hydrogels

Immunofluorescence analysis of apical–basal polarity and proliferation marker Ki67

P26N human colon organoids were grown for 2 days in BME ± the rat anti-integrin β1 antibody AIIB2 (Developmental Studies Hybridoma Bank (DSHB) catalog number AIIB2, Research Resource Identifier (RRID): AB_528306) at a concentration of 1 μg ml⁻¹. Organoids were collected using cell recovery solution (Thermo Fisher) and fixed in 4% formaldehyde (pH 7.4) at 4 °C for 1 h. Hereafter, organoids were washed with PBS 0.1% Tween (PBST) (2% BSA). Three-dimensional imaging of organoids was performed essentially as described previously⁵². In short, organoids were incubated overnight at 4 °C with primary antibodies binding ZO-I (Thermo Fisher Scientific catalog number 61-7300, RRID: AB_2533938), ITGB1 gene product (R and D Systems catalog number MAB1778, RRID: AB_357909) and Ki67 (Millipore catalog number AB9260, RRID: AB_2142366) or ITGA2-encoded gene (Abcam catalog number ab30487, RRID: AB_775702). Following extensive washing with PBST, binding of primary reagents was visualized by overnight incubation in PBST–2% BSA containing donkey anti-rabbit Alexa 568 (Thermo Fisher Scientific catalog number A10042, RRID: AB_2534017) and goat anti-mouse Alexa488 (Thermo Fisher Scientific catalog number A-11070, RRID: AB_2534114). Phalloidin Atto 747N (Sigma-Aldrich) was used for direct visualization of F-actin. DNA was stained with DAPI D1306 (Thermo Fisher). Organoids were optically cleared in a glycerol–fructose clearing solution before imaging. Organoids were imaged on a Leica SP8 confocal microscope. Analysis was done with ImageJ software.

TS2/16 hIgG1 production

We used a simplified workflow to sequence the variable regions of the mouse TS2/16 hybridoma (American Type Culture Collection (ATCC) HB-243) as described⁵³. A human codon-optimized DNA sequence encoding the V_H and V_L domains of antibody TS2/16 was synthesized by GeneArt (Thermo Fisher) and cloned into pFUSEss-CHIg-hG1 and pFUSE2ss-CLIg-hK, respectively (Invivogen). Expression vectors were co-transfected into Expi293F human suspension cells using ExpiFectamine (Thermo Fisher). IgG protein was purified by affinity chromatography using CaptivAHF protein-A affinity resin (Repligen), followed by size-exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva).

TS2/16 scFv production in E. coli

E. coli codon-optimized DNA coding sequences of the TS2/16 scFvs (Supplementary Fig. 3) were synthesized by GeneArt (Thermo Fisher) and cloned into a pET21 vector harboring a C-terminal 6x-HIS tag (Novagen) using standard molecular biology techniques. Protein expression induction, using 1 mM IPTG (Sigma), was done in BL21(DE3) cells starting with an optical density (OD)⁶⁰⁰ of 0.6 in standard lysogeny broth (LB) medium. Production was at 28 °C for approximately 18 h. Bacterial pellets obtained were resuspended in lysis buffer (50 mM Tris pH 7.5, 200 mM NaCl, 10% glycerol, 0.4% Triton ×100) and then sonicated (5 cycles; 10 s on, 20 s off). The insoluble fraction, obtained by centrifugation at 20,000 × g for 15 min, was guanidine–hydrochloride solubilized and refolded as described previously²⁰. The partially purified and refolded scFv was further purified using Ni-NTA (Qiagen), followed by size-exclusion chromatography using a Superdex S200 increase 10/300 GL size-exclusion column (Cytiva) in HBS (10 mM HEPES, pH 7.2, 150 mM NaCl). An analysis of the quality of protein purification was performed running samples, under reducing and non-reducing conditions, on a 4–15% TGX precast SDS-PAGE (Biorad) gel. Proteins were visualized using InstantBlue Coomassie Protein stain (Abcam).

scFv TS2/16 production in Expi293 cells

The coding sequence of the TS2/16 scFv (V_H–V_L orientation) containing the artificial human kappa L-chain signal sequence, and C-terminal tags (8×His tag), HRV 3C site (LEVLFQ/GP), Fc-tag (huIgG1) and a stop codon, was cloned into the pcDNA3.1 mammalian expression vector (Extended Data Fig. 4). Expression was performed by transient transfection of Expi293 cells using the ExpiFectamine transfection kit (Gibco) according to the manufacturer’s instruction. After 4 days, the TS2/16 scFv-Fc was captured from the conditioned media with CaptivA⁻HF protein-A affinity resin (Repligen, CA-PRI-0100) and eluted with IgG elution buffer (Thermo Scientific) containing 300 mM NaCl and neutralized with 100 mM Tris pH 8.0 to reach eventually pH 7.0. The sample buffer was exchanged to 1 × HBS (20 mM HEPES pH 7.3, 300 mM NaCl) using Amicon centrifugal filters (MWCO 30 kDa) and treated with PreScission protease (Cytiva) overnight at 4 °C. Next, the Fc-tag was captured with CaptivA⁻HF protein-A affinity resin and the PreSission protease with Glutathione Sepharose 4C (Cytiva). Finally, the TS2/16 scFv was purified on size-exclusion chromatography with Superdex 75 Increase 10/300 GL column (Cytivia) on the ÄKTA pure chromatography system (Cytivia) in 1 × HBS running buffer (20 mM HEPES pH 7.3, 300 mM NaCl). The TS2/16 scFv was then concentrated using Amicon centrifugal filters (Millipore, MWCO 10 kDa) and sterilized by filtration over a 0.22-μm centrifugal filter (Merck). Protein concentration was determined via NanoDrop A280 reading using the respective protein molecular weight and extinction coefficient. Size-exclusion chromatography and SDS-PAGE analysis for final quality control are shown in (Extended Data Fig. 4).

Integrin β1 ectodomain production and immunoprecipitation

We used the procedure reported previously²⁰ to recombinantly produce the extracellular domain of β1 subunit in the absence of any α-subunit. Deletion of the ~30 amino acid specific-determining loop in the I-like domain is essential for stable secretion of this ectodomain. The DNA coding sequence was synthesized by GeneArt (Thermo Fisher) and cloned into vector pcDNA3.1 (Addgene). Expression vector was transfected into Expi293F human suspension cells using ExpiFectamine (Thermo Fisher). Purification of the C-terminally Flag epitope tagged was performed by absorption of secreted protein to M2-agarose beads (Sigma), and elution by excess 3 × Flag peptides (Sigma). Eluted proteins were subsequently subjected to size-exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva). For immunoprecipitation experiments of the β1 ectodomain, we used ProteinG (Sigma) or M2-agarose (Sigma). All washes and antibody incubations were in standard PBS. The anti-integrin β4 antibody (Abcam catalog number ab110167, RRID: AB_10866385), the anti-β1 antibody (R and D Systems catalog number MAB1778, RRID: AB_357909) and the anti-HUTS4 (Millipore catalog number MAB2079Z, RRID: AB_11214024), M2 anti-Flag (Sigma-Aldrich catalog number F3165, RRID: AB_259529), anti-Flag HRP (Abcam catalog number ab49763, RRID: AB_869428) and anti-6 × HIS HRP (R and D Systems catalog number MAB050H, RRID: AB_357354) antibodies were used. We used 4–15% SDS-PAGE gel (Biorad) under reducing conditions, and PVDF membrane (Immobilon) for blotting. Enhanced chemiluminescence (ECL) (GE HealthCare) was used in the study.

Adhesion assays of K562 cells

Erythroleukemia cell line K562 cells (Thermo Fisher Scientific) were cultured in DMEM (Gibco) with 100 U ml⁻¹ penicillin–streptomycin and 5% FBS (Sigma-Aldrich). Bovine fibronectin (Thermo Fisher) was diluted to 20 μg ml⁻¹ in PBS and incubated overnight at 4 °C in a flat-bottom 96-well plate (Greiner). Subsequently, wells were blocked with 2% BSA in PBS for 30 min at room temperature. K562 cells were resuspended in DMEM/F12 advanced medium (Gibco). Wells were loaded with equal amounts of cells, in the absence of antibodies, or presence of 5 nM of TS2/16 in scFv or IgG format. Following incubation of cells for 90 min at 37 °C, unbound cells were removed by three washes with DMEM-F12 advanced medium. The number of adherent cells was analyzed by bright-field microscopic images and a luciferase-based ATP assay (CellTiter-Glo Promega).

FACS staining integrins

Colon (P26N) and duodenum (Duo-72) organoids were enzymatically processed to single cells and incubated with integrin component-specific antibodies, each directly conjugated to a different fluorophore. Stained cells were forward scatter (FSC) and side scatter (SSC) gated to remove debris and to focus the integrin analysis on live cells. Analysis of antibody staining was performed on 10⁴ cells per analysis and compared with the same unstained cells. Stainings were performed by using combinations of the directly fluorochrome-conjugated antibodies listed below:

1. (1)

   Catalog number ab 303014, Biolegend, RRID: AB_493580, APC/cyanine 7 anti-human CD29 antibody Ts2/16 integrin β1

2. (2)

   Catalog number ab 313619, Biolegend, RRID: AB_2128022, Pacific blue anti-human/mouse CD49f antibody GoH3 integrin α6

3. (3)

   Catalog number ab 328009, Biolegend, RRID: AB_893368, PE anti-human CD49e antibody SAM-1 integrin α5

4. (4)

   Catalog number ab 343808, Biolegend, RRID: AB_10641282, APC anti-human CD49c antibody ASC-1 integrin α3

5. (5)

   Catalog number ab 328311, Biolegend, RRID: AB_2566271, PE/cyanine 7 anti-human CD49a antibody integrin α1

6. (6)

   Catalog number ab 30486, Abcam, RRID: AB_775704,FITC anti-integrin α2 antibody (AK7)

Mn²⁺ growth assay

Ileum N39 (ref. ⁴²) organoids cultured in BME were released from the matrix by incubation with dispase (10 U ml⁻¹) at 37 °C (ref. ⁵). The organoids were then washed with cold DMEM/F12 medium and centrifuged (5 min, 4 °C, 300 × g) to remove residual dispase. The pelleted organoids were treated with TrypLE (no rho kinase inhibitor) at 37 °C to generate cell clusters. This enzymatic reaction was stopped by adding cold DMEM/F12, followed by centrifugation to pellet the cell clusters. The resulting cell clusters were resuspended in 2 mg ml⁻¹ PureCol EZ Gel or BME and plated as small collagen droplets (10–20 µl). The plate was incubated at 37 °C for 1 h to allow for complete collagen polymerization. After polymerization, the collagen droplets were overlaid with complete expansion medium supplemented with either 1 mM Mn²⁺ or 5 nM scTS2/16. On the first day of the cultures, 10 µM of rho kinase inhibitor Y-27632 was supplemented to the culture media as well. After day 1, the ileum organoids were maintained in expansion medium supplemented with either 1 mM Mn²⁺ or 5 nM scTS2/16, with the medium refreshed every 2–3 days. On day 7, organoid cultures were imaged using bright-field microscopy followed by quantification of viable organoids using CellTiter-Glo.

N39 ileum FUCCI reporter organoid line

The FUCCI sequence comprising mCherry-Cdt1-T2A-Geminin-hmAzami-Green was PCR amplified from a construct provided as a gift by G. Kops (Hubrecht Institute). With the use of a Gibson Assembly (NEBuilder HiFi DNA Assembly), it was cloned into a p2Tol-based vector harboring puromycin resistance (Addgene category catalog number 714859). Reporter organoids were generated by co-electroporation of 5 µg of the FUCCI expression construct together with 5 µg mT2TP transposase mediating the tol2-dependent random integration into the cell’s genome. Stable transfectants were isolated based on puromycin resistance and expression of both FUCCI fluorescent signals.

qPCR for intestinal differentiation markers

RNA was extracted using a QIAwave RNA Minikit (catalog number 74534) according to the manufacturer’s protocol. cDNA was synthesized using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit. Real-time PCR was performed on the Biorad CFX96 Real Time PCR System using iQ SYBR Green Supermix 1708880.

The primer sets used were the following:

ITGA2 CRISPR–Cas9 base editing

For single-guide RNA (sgRNA) plasmid preparation, the following sequence was ordered containing a universal priming part and the sgRNA (underlined): TTGTGTAATACTGATTCCCCGGTGTTTCGTCCTTTCCACAAG. The additional bold cytosine residue is included to obtain sufficient transcription from the U6 promoter. Side-directed mutagenesis in SpCas9-vector 47511 was done using Q5 high-fidelity polymerase with the mentioned primer and the following universal 5′/phos/- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC primer. Following PCR cleanup, T4-ligase and Dpn1 were used to relegate and generate the plasmid; this was done according to the manufacturer’s protocol (NEB). DNA was transformed into DH5α bacterial cells, and plasmids were verified using Sanger sequencing (Macrogen Europe BV) with sequence primer GGGCAGGAAGAGGGCCTAT.

Organoid electroporation

Organoid electroporation was performed as described previously⁵⁴ with some modifications. Wild-type organoids were maintained in expansion medium. Two days before electroporation, 1.25% (vol/vol) DMSO was added to the organoid medium. Electroporation was done with 10⁶ cells per electroporation with BTXpress solution containing 2.5 μg ITGA2 gene directed sgRNA plasmid, 5 μg plasmid DNA encoding Piggybac transposase, 5 μg plasmid DNA encoding Piggybac hygromycin cassette⁵⁵ and 7.5 μg C>T base editor_eGFP plasmid (Addgene plasmid number 112100). Hygromycin 100 μg μl⁻¹ (Invivogen) selection was started 5 days post-transfection. Then, 14 days after selection, surviving hygromycin selection clones were individually picked and RT-PCR obtained DNA, sequenced with the following primers: ITGA2_fwd GCACCTGCCACCTTCTCCATCA; ITGA2_rev GAAAAGAGGAAAGAAGCAGATT. DNA was obtained using a ZYMO Research DNA isolation kit. During clonal outgrowth and selection, scTS2/16 was always present in the media.

Western blot

Proteins were run on a 4–15% SDS-PAGE gel (Biorad) under reducing and non-reducing conditions. Marker proteins were obtained from Thermo Scientific (26616, Pager ruler). SDS-PAGE gel was transferred to a PVDF membrane (Thermo Scientific reference 88518). Transfer efficiency was controlled with Ponceau staining. For blocking, 5% non-fat milk protein in PBS was used. For direct HIS-tagged protein staining, a mouse anti-HIS tag HRP conjugated antibody (R and D Systems catalog number MAB050H, RRID: AB_357354) was used. Indirect staining for the HIS-tag was performed using anti-HIS (Abcam catalog number S2917, RRID: AB_10641949) in combination with anti-mouse-HRP (R and D Systems catalog number MAB050H, RRID: AB_357354). FLAG-tagged proteins were directly visualized using HRP-conjugated M2 anti-FLAG (Abcam, RRID: AB_869428) or indirectly by combining M2 anti-flag (Sigma-Aldrich catalog number F3165, RRID: AB_259529) and anti-mouse-HRP (Abcam catalog number ab6808, RRID: AB_955441). Chemiluminescent substrate ECL (GE-Healthcare) was used.

Bulk RNA sequencing

RNA was extracted using a QIAwave RNA Minikit (catalog number 74534) according to the manufacturer’s protocol. RNA integrity was measured using the Agilent RNA 6000 Nano kit with the Agilent 2100 Bioanalyzer, and RNA concentrations were determined using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific). RNA integrity number values of RNA samples were typically 9.5–10.0 and never <9.0. RNA libraries were prepared with the TruSeq Stranded messenger RNA polyA kit and single-end (1 × 50 base pairs) sequenced on an Illumina NextSeq 2000. Reads were mapped to the human GRCh37 genome assembly. Differential gene expression analysis was performed using the DESeq2 package in RStudio (v.2022.02.2). Data visualization was performed using the packages ggplot2 and pheatmap in RStudio or manually plotted using GraphPad Prism (v.8.2.0). The coefficient of determination (R²) was determined using either the ggplot2 package in RStudio or GraphPad Prism.

BME and PureCol EZ Gel-based 3D organoid culturing

Organoids grown in BME (Cultrex) were passaged by releasing them first from the matrix by incubation for 20 min on ice in cell recovery solution (Thermo Fisher) supplemented with 10 μM of the Rho-kinase inhibitor Y-27632 (Abmole)⁵. Subsequent DMEM/F12-washed organoids were either mechanically sheared or TrypLE-digested to single cells. Following additional washing with DMEM/F12, organoids were resuspended either in fresh BME or, alternatively, in PureCol EZ Gel (Advanced Biomatrix). For complete gelation of the BME or PureCol EZ Gel gel, plates were incubated at 37 °C for 30 min or 60 min, respectively. Hydrogels were covered with relevant organoid medium and incubated at 37 °C and 5% CO₂. Passaging of organoids growing in collagen was achieved by incubation at 37 °C for 30 min maximally, with collagenase from Clostridium histolyticum (Sigma-Aldrich C0130) diluted in DMEM/F12 to a concentration of 1 mg ml⁻¹. For complete removal of the proteolytic enzyme, organoids were washed twice with an excessive volume of DMEM/F12 medium before re-entry into PureCol EZ Gel. The β1-specific inhibitory AIIB2 antibody was added to organoid cultures at 30 nM. The ITGA6-inhibitory antibody G0H3 was added to organoid cultures as 1:1,000 diluted ascites. The Fab versions of SNAKA51, 9EG7 and 12G10 antibodies were provided by J. Li, Harvard Medical School, Boston Children’s Hospital. Culture images were taken with an EVOS cell imaging microscope.

BME- and PureCol EZ Gel-based 2D organoid culturing

Transwell inserts (Thincerts, 12-well, pore size 0.4 μm, Greiner Bio-One 665641) were coated overnight with 2% dilutions of BME (ref. ⁵) or PureCol EZ Gel in DMEM-F12 medium at 4 °C. Hereafter, inserts were washed twice with DMEM-F12 before the cells were added. Inserts were loaded with approximately ±50,000 cells, prepared as a TrypLE-dissociated single-cell suspension. Following digestion, cells were 40-μm-filtered and washed twice in DMEM-F12 medium in the continuous presence of rho-kinase inhibitor Y-27632 (Abmole). Cells were resuspended in 250 µl relevant culture medium supplemented with rho-kinase inhibitor Y-27632 (overnight) and optionally long term with 5 nM scTS2/16. Subsequently, 1 ml of identical medium was added to the lower compartment. Passaging of the cultures was started by removing media from both compartments, briefly washing with DMEM-F12 and then filling both compartments with TrypLE.

Organoid differentiation media

Patterning medium⁴² is intestinal medium lacking the p38 inhibitor nicotinamide and PGE2, but has 3 μM CHIR 99021 (Stemgent 04-0004-base) and 5 nM scTS2/16.

Maturation medium⁴² is patterning medium lacking CHIR 99021 but having recombinant human IL22 (200-22 Peprotech) at a concentration of 2 ng ml⁻¹. Wnt-Surrogate was present at a 30× lower final concentration (±16 pM).

Organoid differentiation in 2D

For immunofluoresence staining, to allow differentiation of organoids, the intestinal expansion medium in the bottom compartment was replaced for 14 days by ‘patterning’ medium and successively by ‘maturation’ medium⁴². The upper compartment was exposed to air during this period. Hereafter, the medium was removed, tissue 4% PFA-fixed for 20 min, washed twice with excess PBS and permeabilized by incubating in PBS–0.1% Triton X-100–2% BSA for 1 h. Finally, tissue was washed with PBS 2% BSA. For visualization of enterocytes, we stained for the marker ApoA1 by using rabbit antibody PA5-88109 (Thermo Fisher) (RRID: AB_2804657). Goblet cells were visualized by mouse anti-muc2 antibody 11197 (Abcam) (RRID: AB_297837); for enteroendocrine cells, rabbit antibody 23342-1-AP (Proteintech) detecting chromogranin A (RRID: AB_2879259); and for lysozyme secreted by Paneth cells, rabbit antibody GTX72913 (Gene Tex) (RRID: AB_374812). Alexa-conjugated secondary antibodies (1:500) used were donkey anti-mouse Alexa488 (1:500) Thermo Fisher A21202 (RRID: AB_141607) and donkey anti-rabbit Alexa 568 Thermo Fisher A10042 (RRID: AB_2534017). Actin was stained using Phalloidin-Atto 647 from Sigma. DNA was stained with DAPI D1306 (Thermo Fisher). All reagents were diluted in PBS–2% BSA.

PureCol EZ Gel polymerization conditions

Ileum N39 (ref. ⁴²) organoids cultured in BME were first released from the matrix protein using dispase (10 U ml⁻¹)³⁸. The organoids were incubated with dispase at 37 °C for 30 min, after which they were washed twice with cold DMEM/F12 and collected by centrifugation (5 min, 4 °C, 300 × g). The washed organoids were then treated with TrypLE (without rho kinase inhibitor) at 37 °C for 5 min to dissociate the organoids into clusters of cells. To stop enzymatic activity, the cell suspension was washed again with cold DMEM/F12 and centrifuged (5 min, 4 °C, 300 g). The resulting cell pellet was resuspended in 1 ml of one of the following conditions: DMEM/F12, complete expansion medium (EM), EM + Rho kinase inhibitor Y-27632 or EM + Rho kinase inhibitor Y-27632 + scTS2/16. The cell suspension was herein incubated for 30 min (room temperature), allowing conditioning before embedding in hydrogel. After this incubation, cells were centrifuged (5 min, 4 °C, 300 × g) and cell pellets resuspended in 2 mg ml⁻¹ collagen EZcol hydrogel. The suspension was plated in 10–20-µl domes which were then incubated at 37 °C for 1 h to allow polymerization. Hereafter, cultures were covered with EM supplemented with rho kinase inhibitor Y-27632 and 5 nM scTS2/16. The next day, Y-27632 was removed from the medium, and cultures were maintained in EM with 5 nM scTS2/16 to analyze the effect of diffusion of scFv in collagen hydrogels. After 5 days of culture, the number of outgrown organoids was quantified using CellTiter-Glo viability assay (Promega).

Long-term 3D PureCol EZ Gel (Fujii medium)

Ileum (N39) organoids were cultured in expansion medium consisting of DMEM/F12 supplemented with 100 U ml⁻¹ P/S, 10 mM HEPES, 1× Glutamax, 2% B-27 with VitA, 3% (v/v) recombinant R-spondin-3, 2% (v/v) recombinant noggin, 1 mM N-acetylcysteine, 0.5 nM Wnt surrogate, 0.1 µg ml⁻¹ hIGF-1 (Peprotech), 0.05 µg ml⁻¹ hFGF2 (Peprotech), 10 nM gastrin, 0.5 µM A83-01, 0.05 µg ml⁻¹ hEGF, 3 µM CHIR 99021 and 10 µM forskolin (Tocris)⁴². For collagen cultures, ileum organoids grown in BME were first released from the matrix by incubation with dispase (10 U ml⁻¹ for 30 min at 37 °C). Hereafter, organoids were washed twice with cold DMEM/F12 and collected by centrifugation at 300 × g for 5 min at 4 °C. Organoids were then treated with TrypLE (no rho kinase inhibitor) at 37 °C for 5 min and further disrupted mechanically to dissociate organoids into small clumps of cells (avoiding complete single-cell dissociation). Organoids were washed again with cold DMEM/F12, centrifuged under the same conditions and resuspended in 2 mg ml⁻¹ PureCol EZ Gel. The matrix–cell suspension was seeded in 10–20-µl droplets onto a culture plate, which was subsequently incubated at 37 °C for 1 h to allow polymerization. Hereafter, the droplets were covered with the expansion medium supplemented with 10 μM Y-27632 rho-kinase inhibitor (initial 12 h) and 5 nM scTS2/16. The following day, this medium was refreshed, with the expansion medium lacking rho kinase inhibitor but continuing with 5 nM scTS2/16. This medium was refreshed every 2–3 days. For passaging of organoids, the collagen domes were incubated with 1 mg ml⁻¹ collagenase from Clostridium histolyticum (Sigma-Aldrich) for 30 min at 37 °C, and digestion monitored using bright-field microscopy (small clumps of cells). Organoids were collected in a 15-ml tube and washed twice (centrifugation for 5 min at 300 × g) with an excess volume of cold DMEM/F12. The clumps of cells were washed twice and resuspended in fresh PureCol EZ Gel (2 mg ml⁻¹).

3D collagen differentiation protocol

The ileum N39 triple reporter line, with fluorescently marked specific intestinal cell types (goblet cells: Muc2-GFP; enteroendocrine (EEC) cells: CHGA-iRFP; and Paneth cells: DEFA5-dsRED), was described⁴². It was propagated in 3D hydrogel. At both passage 0 (P0) and passage 2 (P2), the organoids were induced to differentiate. Then, 7 days following passaging, the expansion medium was replaced with differentiation medium in all 3 hydrogel conditions: (1) collagen, (2) collagen + scTS2/16 and (3) BME. The differentiation (patterning) medium was prepared as described previously⁴². The differentiation process was monitored daily using EVOS fluorescence microscopy to track the emergence of the differently marked mature epithelial types. After 5 days, mature epithelial cells were observed in the collagen- and BME-cultured organoids. At this point, organoids in all hydrogel conditions were fixed to maintain consistency in imaging and downstream analyses. For quantitative assessment of differentiated secretory cells, we used flow cytometry (BD Fortessa). A total of 5,000 DAPI-negative single cells per hydrogel condition were analyzed to compare differentiation efficiencies to the expansion culture. Organoids were fixed in 4% formaldehyde (pH 7.4) and subsequently analyzed using SP8 confocal microscopy.

Organoid lines

• The human small-intestinal duodenum line Duo-72 was described⁵⁶.

• Jejunum J2 organoids were provided by M. Estes, Baylor College of Medicine. Organoids were described⁵⁷.

• Ileum N39 organoids were described⁵⁸.

• The ileum N39 triple reporter was described⁴²

• Primary colon biopsies (Fig. 5e, N = 4) were derived from the Utrecht Portal for Organoid Technology. Patients (University Medical Center Utrecht (UMCU)) provided informed consent for the generation of such organoids based on protocol UPORT Cancer Biobank 21-042 and was in accordance with the Declaration of Helsinki and Dutch law. This study complies with all relevant ethical regulations regarding research involving human participants.

• P26N colon organoids were described⁴⁷.

• Primary liver human ductal organoids (Fig. 5f, N = 3) were derived from UMC biopsy codes 057932, 061530 and 061500. The study was approved by the UMCU ethical committee (TCBio 21-042) and was in accordance with the Declaration of Helsinki and Dutch law. This study complies with all relevant ethical regulations regarding research involving human participants.

• The ductal pancreas line, code HUB-08-A2-007, was obtained from the biobank of UMCU (Toetsingscommisie Biobanken TCBio (Biobank research Ethic Committee)) approved by protocol 12-093 HUB-Cancer and informed donor consent.

• Established human liver and pancreas ductal lines were described earlier⁵⁹.

All patients participating in this study signed informed consent forms approved by the responsible authority. In all cases, patients can withdraw their consent at any time, leading to the prompt disposal of their tissue and any derived material. Future distribution of organoids to an academic party will have to be authorized by the Medical Ethics Committee of the UMCU (TCBio).

Statistics

All effects measured between two groups, in response to agonistic (TS2/16) or antagonistic (AIIB2 or G0H3) antibodies, such as CellTiterGLO units—number of cells—or fold-change differences in gene expression levels in qPCR, were tested for significance using one-tailed t-tests. P values and the number and type of replicates (designated n) are provided in the relevant legends of the main figures, extended data figures and supplementary figures. Significance of results from bulk sequence comparisons (Extended Data Figs. 9 and 10) were analyzed using a Wald test for negative binomial distribution in the expression between scFv and control samples. Bonferroni correction was applied to adjust for multiple testing. The number of independent identical experiments is designated N in all legends.

Organoid expansion medium

Organoid expansion medium for each organoid type included the following components: a ‘+’ indicates that the component is present in the medium for the corresponding organoid.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.